[Trollbait] Questions creationists can't answer?

This forum is for the discussion of the evidence for evolution. Anyone is welcome to post, however, scripture is not allowed. As the title says, Science Only please!

Moderator: Moderators

Re: [Trollbait] Questions creationists can't answer?

Postby Roger Stanyard » Wed Mar 21, 2012 9:38 am

MrDunday wrote:Roger wrote:


All of it is wrong. It's argument from incredulity. Idiotic maths as well.

Which of the following lines has more information in it?

The cat sat on the mat.

ACGTACGTACGTACGTACGTACG

"9--><£$&F#@?}]|Q=!up5n

AAAAAAAAAAAAAAAAAAAAAAA


MrDunday wrote:What part of what I said is wrong?
I like the one that says a cat sat on the mat.

Please try to answer with the science.
When you said circles, did you mean circular thinking?


No. You answer the dam question. It is you who are making claims about information.

Just demonstrate to everyone here you know what you are talking about rather than waffling your way out of your own ignorance.

If, as you claim, design is obvious, show us how it can be measured by answering my very simple question.
Those who believe absurdities will commit atrocities - Voltaire
User avatar
Roger Stanyard
Forum Admin
 
Posts: 6162
Joined: Sat Oct 07, 2006 4:59 pm

Re: [Trollbait] Questions creationists can't answer?

Postby cathy » Wed Mar 21, 2012 7:38 pm

Just out of interest Mr Dunday, do you see anything scientific in this one?
ACGTACGTACGTACGTACGTACG


Or this one?
"9--><£$&F#@?}]|Q=!up5n
cathy
 
Posts: 3665
Joined: Wed Apr 21, 2010 6:51 pm
Location: Redditch

Re: [Trollbait] Questions creationists can't answer?

Postby MrDunday » Wed Mar 21, 2012 9:03 pm

Roger Stanyard wrote:
MrDunday wrote:Roger wrote:


All of it is wrong. It's argument from incredulity. Idiotic maths as well.

Which of the following lines has more information in it?

The cat sat on the mat.

ACGTACGTACGTACGTACGTACG

"9--><£$&F#@?}]|Q=!up5n

AAAAAAAAAAAAAAAAAAAAAAA


MrDunday wrote:What part of what I said is wrong?
I like the one that says a cat sat on the mat.

Please try to answer with the science.
When you said circles, did you mean circular thinking?


No. You answer the dam question. It is you who are making claims about information.

Just demonstrate to everyone here you know what you are talking about rather than waffling your way out of your own ignorance.

If, as you claim, design is obvious, show us how it can be measured by answering my very simple question.


If your referring to the scientists idea of 'evolution' , it demands that the origins of life, be from non creation.That is circular thinking.

I still say The cat sat on the mat.
MrDunday
 
Posts: 127
Joined: Sat Mar 03, 2012 3:27 pm

Re: [Trollbait] Questions creationists can't answer?

Postby MrDunday » Wed Mar 21, 2012 10:05 pm

cathy wrote:Just out of interest Mr Dunday, do you see anything scientific in this one?
ACGTACGTACGTACGTACGTACG


Or this one?
"9--><£$&F#@?}]|Q=!up5n

the first one is from the DNA code, but it is very short. It could be taken from actual DNA sequencing, or it could be just random letters but limited to just 4 letters.But if enough of these 4 letters could build something, it would show intelligence. Because you would have to ask how that coding got there? Just random sequencing would not do that.The DNA in life needs to be coded, it is not random.

AAAAAAAAAAAAAAA could be a part of a binary code,or how many A's might be a simple code, or just something hit the A letter for a few seconds.

"9--><£$&F#@?}]|Q=!up5n this one just looks like random letters and numbers. But at the same time if it was done on a computer something had to be playing with the key board which requires intelligence because some of those, needs 2 keys to be pressed at the same time. It is also possible it is a code, which you would need a 'key' to unlock it. It doesn't really look like math symbols to me. But if is, that would be intelligence.

'The cat sat on a mat' I like this one for many reasons. It is a sentence and words, and not just random letters. this tells you it took intelligence. because you are communicating to someone else with that sentence. Because it is also talking about a cat, that cat had to be designed, the DNA code would have to be exact and copied many times. It also has to make body parts and brain cells etc. A staggering amount of intelligence would be needed.
Because he sat on a mat, the mat shows intelligence , because it was designed to serve a purpose, and placed as a mat. The mat itself would show intelligence because it may be made from plant material that also requires intelligence, because of the coded DNA, and because the mat had to be designed and made and placed.You would have to find out who or what made it. If you decide that a human made it then there is a huge amount of intelligence in the building of humans. If it has a pattern, then that has to be accounted for. there is much more to this, this i what I thought of.
Also some of these are recognizable to us because we know humans do this.I don't know if this was what you were looking for or not?
You just asked what has more information in it.

Here is a simple experiment to test for ID

1-find life just happening someplace
2- record all the knowledge , and experience it takes to create life in a lab. This is ID.
3 compare the 2 parts of this.
MrDunday
 
Posts: 127
Joined: Sat Mar 03, 2012 3:27 pm

Re: [Trollbait] Questions creationists can't answer?

Postby MrDunday » Wed Mar 21, 2012 10:18 pm

Roger Stanyard wrote:
MrDunday wrote:Well that is what I was hoping for. There must be a better chance for a Harley to show up, than life.


Well, show us the maths as you are talking about probability.

Or can't you?

You don't need math, both are impossible without intelligent design and the required experience to build. But the cell is much harder to do. At least that is with humans. People can build a Harley, but are not able to build a cell yet. It requires much more intelligence and knowledge to do. We don't just find either of those, just happening.
MrDunday
 
Posts: 127
Joined: Sat Mar 03, 2012 3:27 pm

Re: [Trollbait] Questions creationists can't answer?

Postby Roger Stanyard » Wed Mar 21, 2012 10:55 pm

MrDunday wrote:I still say The cat sat on the mat.


Nope.
Those who believe absurdities will commit atrocities - Voltaire
User avatar
Roger Stanyard
Forum Admin
 
Posts: 6162
Joined: Sat Oct 07, 2006 4:59 pm

Re: [Trollbait] Questions creationists can't answer?

Postby Roger Stanyard » Wed Mar 21, 2012 10:57 pm

MrDunday wrote:
Roger Stanyard wrote:
MrDunday wrote:Well that is what I was hoping for. There must be a better chance for a Harley to show up, than life.


Well, show us the maths as you are talking about probability.

Or can't you?

You don't need math, both are impossible without intelligent design and the required experience to build. But the cell is much harder to do. At least that is with humans. People can build a Harley, but are not able to build a cell yet. It requires much more intelligence and knowledge to do. We don't just find either of those, just happening.


Wrong.
Those who believe absurdities will commit atrocities - Voltaire
User avatar
Roger Stanyard
Forum Admin
 
Posts: 6162
Joined: Sat Oct 07, 2006 4:59 pm

Re: [Trollbait] Questions creationists can't answer?

Postby Roger Stanyard » Wed Mar 21, 2012 10:58 pm

MrDunday wrote:
cathy wrote:Just out of interest Mr Dunday, do you see anything scientific in this one?
ACGTACGTACGTACGTACGTACG


Or this one?
"9--><£$&F#@?}]|Q=!up5n

the first one is from the DNA code, but it is very short. It could be taken from actual DNA sequencing, or it could be just random letters but limited to just 4 letters.But if enough of these 4 letters could build something, it would show intelligence. Because you would have to ask how that coding got there? Just random sequencing would not do that.The DNA in life needs to be coded, it is not random.

AAAAAAAAAAAAAAA could be a part of a binary code,or how many A's might be a simple code, or just something hit the A letter for a few seconds.

"9--><£$&F#@?}]|Q=!up5n this one just looks like random letters and numbers. But at the same time if it was done on a computer something had to be playing with the key board which requires intelligence because some of those, needs 2 keys to be pressed at the same time. It is also possible it is a code, which you would need a 'key' to unlock it. It doesn't really look like math symbols to me. But if is, that would be intelligence.

'The cat sat on a mat' I like this one for many reasons. It is a sentence and words, and not just random letters. this tells you it took intelligence. because you are communicating to someone else with that sentence. Because it is also talking about a cat, that cat had to be designed, the DNA code would have to be exact and copied many times. It also has to make body parts and brain cells etc. A staggering amount of intelligence would be needed.
Because he sat on a mat, the mat shows intelligence , because it was designed to serve a purpose, and placed as a mat. The mat itself would show intelligence because it may be made from plant material that also requires intelligence, because of the coded DNA, and because the mat had to be designed and made and placed.You would have to find out who or what made it. If you decide that a human made it then there is a huge amount of intelligence in the building of humans. If it has a pattern, then that has to be accounted for. there is much more to this, this i what I thought of.
Also some of these are recognizable to us because we know humans do this.I don't know if this was what you were looking for or not?
You just asked what has more information in it.

Here is a simple experiment to test for ID

1-find life just happening someplace
2- record all the knowledge , and experience it takes to create life in a lab. This is ID.
3 compare the 2 parts of this.


All completely wrong.
Those who believe absurdities will commit atrocities - Voltaire
User avatar
Roger Stanyard
Forum Admin
 
Posts: 6162
Joined: Sat Oct 07, 2006 4:59 pm

Re: [Trollbait] Questions creationists can't answer?

Postby MrDunday » Wed Mar 21, 2012 11:24 pm

cathy wrote:Mr Dunday you are looking at this the wrong way, in a way that does show a lack of understanding of science.

On several ocassions you were asked to define what you meant by life. When you were saying life comes from life and the same question is pertinent now you are talking about the cell.

The reason you were asked to define life is that life has many different features. For example reproduction, excretion some kind of metabolism. Children here learn that very early on in a simplified from using the mneumonic MRS GREN to help them. Obviously learning a more sophisticated version later on should they consider taking biology further.

Now no scientist thinks living cells just appeared. Because that would be highly improbable. What they look at is the many features that make up the simplest living things and look to see which are most likely to have appeared first (current research is most interested in metabolism or SIMPLE replication - not of cells). Some scientists look at that. Now in this search for the first features of early life, there are many interesting hypothesis.

They are not 'designing' life in that research as you've suggested earlier when trying unsuccessfully to defend the religious view that is ID. They are trying instead to repllicate the early conditions of life and the chemicals that would be present. I suggest you read some of that research.

Others scientists look at how a new feature could have arisen once some features are in place or how very simple things could have evolved - adding to the features that would eventually lead to life. Others look at how single cells could become groups of cells or how smaller simpler cells could join together to form more complex eukaryotic cells via something called endosymbiosis. I'm trying to simplify this as much as possible for you cos if you've been on creationist sites your understanding of biology will have been warped and mangled.

Do you understand the point I'm trying to make? For all stages to happen simultaneously to give a cell is unlikely. But each step is far more likely and did happen as we do have life. It is a slow building bit by bit process not a magic wand shove it all together and there you go one. It does not preclude a God, merely makes him clever enough to understand chemistry. Though creationists on the websites you frequent do preclude a God by making him dependent on their simplistic understanding of the world and too stupid to understand chemistry.

And not knowing is not an issue. 200 years ago we didn't know how the blood circulated or what the pancreas did. That wasn't a reason to stop looking and say blood must towed around by magic fairies. We kept looking till we found it. And 300 years ago we didn't even know the cell existed let alone what it did. That doesn't mean it didn't.

Not knowing is what science thrives on. That is science. If creationists had been around 300 years ago they'd have been saying 'cells - impossible and cos you don't know they exist yet thats a real problem for evolution'. That is the argument you are using now. Sounds stupid doesn't it.

Secondly your Harley example is not very good. Firstly cos machines are very different to living things. However leaving that aside, I understand the analogy you are trying to make. But it doesn't work I'm afraid.

For it to work as you want it to ie to support the notion that only a designer can come up with something complex like life, someone at the very start of human innovation, hundreds of thousands of years ago should have designed and built the Harley or something equally technically complex from scratch without calling on prior technologies, science and inventions. That did not happen.

The Harley is the culmination of years of innovation, invention, scientific discovery, earlier models and so on. The Harley in its current form couldn't be built till someone had developed ways of extracting and working metals, refining and improving them. That process has been 'evolving' for thousands of years.

It couldn't be built till someone had understood how to use power to turn wheels and then developed that power from steam to petrol - again over hundreds of years. The steam engine is just someone co opting a kettle to turn wheels rather than make tea after all.

In short the Harley is something that slowly evolved over time from tiny improvements to simpler things like carts and from using simpler pieces of knowledge like steam to petrol that gradually came together stretching back to the wheel. The Harley is just an improvement or change or adaptation (or not) on something, which was in itself an improvement. A little bit like the bacterial flagellum which can be traced back to a simple pore or blood clotting or a myriad other things that desperate IDers lie about.

Now sorry if this has sounded over simplistic and patronising, but spending any time at all on creationist sites (and your arguments are straight from them Mr Dunday - including the Harley one) does rot critical faculties so I've gone back to very, very basic explanations. My only advice is ditch creationism Mr Dunday. There is nothing good about it. It makes religion and God a joke.

Here is the definition of life

1. the condition that distinguishes organisms from inorganic objects and dead organisms, being manifested by growth through metabolism, reproduction, and the power of adaptation to environment through changes originating internally.

2. the sum of the distinguishing phenomena of organisms, especially metabolism, growth, reproduction, and adaptation to environment.

So a cell is also life. There is no evidence that life could just happen . As you say it s very unlikely. But with DNA it is impossible with out creation. That DNA has to be coded. There is no randomness in that. Even a little mistake can cause huge damage. Some times the scientists like to throw a huge number, of the probability of DNA being coded. This sometimes make many think it is possible, no matter how remote it is. Sort of like gambling. But this is not gambling. This is ,say, for a million throws of the dice, and you have 4 dice, you have to get every throw, down perfectly every time.Not just the correct numbers but also the dice have to the table in the correct sequence. This has nothing to do with odds.
That's is true creationist did not know about cells 300 years ago. Neither did the scientists. When they found out they should have known something was wrong, with their ideas. Cells function like little factories.They do not happen by accident. When they discovered DNA and then the code in it, that really killed 'evolution' and a non creative start to life. There is no possible way the DNA could happen by chance or even 'evolve into the code needed. The scientist need specialized machines even to read it. Yet in cells the DNA is separated and copied and put back together. It also coordinates, all the processes in the cells, it tells the proteins where to go and at what time and how to fold for a specific purpose.
Cells are little machines, the difference is the are biological. But even the scientist say if computers were made with biological materials they would be much faster and hold a lot more information. They barley have an idea what the brain is all about. This is not by chance. Where would the scientists begin if they wanted to create a brain?

Actually these are my examples. I am starting to see my little examples show up from others now.
Please do not be afraid to use simple explanations. Einstein said if it is simple and elegant it probably is true.
That's why no one has been able to break my 3 facts with evidence.

It is not only complicated. It is a staggering amount of precise code, in the DNA, and cells have to be complete be fore they work, and are considered life. The scientist will never get past this. It is like a computer scientist writing code. If a key board was hit with branches in the wind and was producing letters on the screen, how likely is it likely to produce and long complicated program? It would never happen. That is the difference of intelligence and random hits of those branches.
Actually religions has given God a bad name. They have not represented, God and creation very well. Actually they have pushed many take up other ideas. Not just because of the science but the understanding of the bible and hypocritical examples that they are.
I certainty get why many think God or the bible is a joke. But just like their ideas about life, the scientists assume the bible is not correct because of the actions of many religions. Just as they assume think things just happened. So the scientists have done the same things as some religions.
If you look at the actual evidence, there is nothing that supports what they are saying. They can't show us 'evolution' or the origins as they hypothesize.
my 3 facts hold
1 life comes from life
2 a human comes from humans
2 there is design in life.
You have to show with evidence that these are wrong. But the scientist can't do that. They can only use there hypotheses as evidence. That is circular thinking and not scientific.
MrDunday
 
Posts: 127
Joined: Sat Mar 03, 2012 3:27 pm

Re: [Trollbait] Questions creationists can't answer?

Postby a_haworthroberts » Wed Mar 21, 2012 11:32 pm

Any chance of you being a bit more concise Wayne? So we can see exactly what you are suggesting.
a_haworthroberts
 
Posts: 8951
Joined: Sun Jun 13, 2010 1:49 am
Location: United Kingdom

Re: [Trollbait] Questions creationists can't answer?

Postby MrDunday » Thu Mar 22, 2012 2:35 am

Roger wrote:

Wrong.


OK let me know what you think the answer is? And why?
Last edited by MrDunday on Thu Mar 22, 2012 2:51 pm, edited 1 time in total.
MrDunday
 
Posts: 127
Joined: Sat Mar 03, 2012 3:27 pm

Re: [Trollbait] Questions creationists can't answer?

Postby MrDunday » Thu Mar 22, 2012 2:38 am

a_haworthroberts wrote:Any chance of you being a bit more concise Wayne? So we can see exactly what you are suggesting.

Do you mean my 3 facts?
MrDunday
 
Posts: 127
Joined: Sat Mar 03, 2012 3:27 pm

Re: [Trollbait] Questions creationists can't answer?

Postby Roger Stanyard » Thu Mar 22, 2012 9:05 am

MrDunday wrote:
Roger wrote:

Wrong.


OK let me know what you think the answer it? And why?


How do we measure information?

This is bog standard maths which we all use everyday.

"meaning" is not a measure of information.

In each of the four lines, there is (or least should be) exactly the same number of characters.

So which of the four lines is most difficult to measure mathematically?

In mathematics (or, indeed, in general) is a highly improbable outcome highly unlikely, likely or a racing certainty?
Those who believe absurdities will commit atrocities - Voltaire
User avatar
Roger Stanyard
Forum Admin
 
Posts: 6162
Joined: Sat Oct 07, 2006 4:59 pm

Re: [Trollbait] Questions creationists can't answer?

Postby Roger Stanyard » Thu Mar 22, 2012 9:14 am

MrDunday wrote:
Roger Stanyard wrote:
MrDunday wrote:Well that is what I was hoping for. There must be a better chance for a Harley to show up, than life.


Well, show us the maths as you are talking about probability.

Or can't you?

You don't need math, both are impossible without intelligent design and the required experience to build. But the cell is much harder to do. At least that is with humans. People can build a Harley, but are not able to build a cell yet. It requires much more intelligence and knowledge to do. We don't just find either of those, just happening.


If you are talking about probability then you need the maths to back up your otherwise unsubstantiated assertion.

Why is it that "9--><£$&F#@?}]|Q=!up5n (which is utter gobbledegook) have more information in it that the other three lines?
Those who believe absurdities will commit atrocities - Voltaire
User avatar
Roger Stanyard
Forum Admin
 
Posts: 6162
Joined: Sat Oct 07, 2006 4:59 pm

Re: [Trollbait] Questions creationists can't answer?

Postby cathy » Thu Mar 22, 2012 11:23 am

Well that is what I was hoping for. There must be a better chance for a Harley to show up, than life.

Except as I've already pointed out the Harley was not designed from scratch, brand new with no predecessors. First came the wheel, then improvements on that, fire, kettles, add them to wheels to get trains, metal extraction, improvements in metal extraction and metals, discovery of oil, refinement, the penny farthing, improvements to get the bicycle, vulcanisation of rubber for tyres, petrol engines, primitive cars, primitive motorbikes, improvements till the last improvement which led to the modern Harley.

Big designed motobike from advanced materials and advanced refined fuels from scratch - improbable. Small improvement to last years Harley - easy peasy. Which is improvement on ten years ago and so on. Do you understand that simple fact and why it makes your argument crap. Why that part of the design analogy, whilst still not appropriate for living things, works better for evolution but IDers are too thick to see it. And Japanese bikes are better anyway.

Same with cell. Not all appearing at once. No DNA plus protein plus metabolism suddenly showing up. Simple features of life not ALL the features of life. I tried to write that as simply as possible in my previous post. Which bit did you not get? Have you got it now?

It is not only complicated. It is a staggering amount of precise code, in the DNA,
And it is all useful is it? And efficiently stored? And have you never considered natural selection?
cathy
 
Posts: 3665
Joined: Wed Apr 21, 2010 6:51 pm
Location: Redditch

PreviousNext

Return to Science Only

Who is online

Users browsing this forum: No registered users and 0 guests

cron